Chemistry & Biology

Primer Melting Temperature Calculator

Price a primer’s melt with the two bench rules: the Wallace count for short oligos, the salt-adjusted formula for primer length — and the honesty to say where both stop working.

Primer Melting Temperature Calculator

Results recalculate instantly on every keystroke. Nothing you type is transmitted.

The sequence
The melting temperature
—
Which rule fired—
The design crib—
The Tm conventions—

What this result does not account for

  • Bench rules only — no nearest-neighbor thermodynamics
  • Salt-adjusted formula assumes ≈50 mM monovalent, no Mg
● Zero-Server Execution Updated 11 Aug 2026 Reviewed by Dr. Ayesha Rahman IEEE-754 Double Precision

In short: The default 20-mer ACGTGGTACCGTACTAGCTT counts A 4, C 5, G 5, T 6 — GC 50.000000% — and the basic salt formula prices Tm ≈ 51.780000 °C at its assumed ≈50 mM salt. A 12-mer such as ACGTACGTACGT falls to the Wallace rule instead: 2°C per A-T plus 4°C per G-C prints 36.000000 °C. Past 70 nt the page stops and names the nearest-neighbor programs as the professional standard.

Formula

<14 nt: Tm = 2(A+T) + 4(G+C) · ≥14 nt: Tm = 64.9 + 41×(G+C − 16.4)/N

Two approximations, hand-off at 14 nucleotides. The Wallace rule adds 2 °C per A-T pair and 4 °C per G-C pair — a count, good for short oligos. From 14 nt the basic salt formula takes over, tuned on 14–20-mers and assuming about 50 mM monovalent salt; it is the number bench sheets quote. Both assume pH near 7 and no formamide; nearest-neighbor thermodynamics is what probes and papers actually quote.

Worked Example

  1. Paste the primer (A, C, G, T).
  2. Read the Tm and which rule produced it.
  3. Check the GC share against the design crib.
  4. Past 70 nt, take the sequence to a nearest-neighbor tool.

Defaults: the 20-mer → 51.780000 °C (basic salt formula). ACGTACGTACGT → Wallace 36.000000 °C. GCGCGCGCGCGCGC (14-mer, all GC) → 57.871429 °C. ATATATATATATAT (14-mer, all AT) → 16.871429 °C — the GC swing on the same length is 41 degrees.

Strengths & Limits Of This Model

Where this engine is strong

  • Two rules, honest hand-off at 14 nt
  • The 70 nt ceiling names the professional road

Where it stops

  • No magnesium or additive correction
  • No dimer or hairpin screening

Risk & accuracy notice. Annealing temperatures chosen from any formula deserve an empirical gradient on a first run; no Tm estimate replaces a melt curve for a make-or-break assay.

Practical Use Cases

PCR setup

annealing temperature near the lower Tm

Probe checks

short-oligo Wallace sanity

Teaching

where the rules hand off

Methodology & Editorial Standards

Computation runs in IEEE-754 double precision at full internal precision; rounding to two decimal places occurs strictly at the display layer, so no cumulative drift enters the result. All monetary outputs use accounting presentation — grouped thousands, two decimals, negatives in parentheses — so figures can be transcribed directly into a model or working paper. Division-by-zero and out-of-domain inputs return an em-dash rather than a misleading number.

This engine was reconciled against an independent reference implementation and hand-verified for the worked example above before release. Our full five-stage review process is published on the About Us page.

Dr. Ayesha Rahman Clinical & Life Sciences Lead · ApexConverter

Analytical chemistry and molecular biology quantitation. Last reviewed: 11 August 2026.

Disclaimer. This calculator is provided for informational and modelling purposes only and does not constitute financial, tax, legal, medical, or engineering advice. Verify all figures with a qualified professional before acting on them.


Primer Melting Temperature Calculator — 8 Expert FAQs

8 analyst-written answers to the questions practitioners actually ask — optimised for voice and answer-engine retrieval.

Why two rules instead of one formula?

Because each was tuned on a different length and honest about it. The Wallace rule is a counting trick for short oligos; the 64.9 formula was built from 14–20-mer data and says nothing about a 70-mer. Handing off at 14 nt keeps each rule inside the range that measured it, and the page names which one fired so you always know which approximation you are holding.

What salt does the 64.9 formula assume?

About 50 mM monovalent — the standard PCR buffer’s ballpark. Real magnesium matters too and the formula ignores it, which is one more reason the number is a bench starting point, not a thermodynamic quantity. If your buffer is unusual, expect the true melt to move and run an empirical gradient instead of trusting any formula.

Why the 70 nt ceiling?

Because past it both bench rules drift badly — long oligos need nearest-neighbor thermodynamics, which sums stacking energies pair by pair and is what synthesis houses and papers actually quote. The page refuses to fake it: a 100-mer paste gets named as nearest-neighbor country, not a made-up number.

How close should a primer pair’s Tm values be?

Within about 5 °C of each other so both strands anneal in the same temperature window; the annealing temperature itself is usually set a few degrees under the lower Tm. The design crib prints the classic ranges — 18–25 nt, 40–60% GC — but the pair match matters more than any single perfect primer.

What is the GC clamp?

One or two G or C letters at the 3′ end. They anchor the polymerase’s starting grip without over-stabilizing; three in a row invite mis-priming and are better avoided. The GC card gives the counts to check the ends by eye — the clamp is a design convention, not part of any formula.

Why is my real PCR annealing temperature lower than this Tm?

Because Tm is where half the duplex separates, not where priming is best. Annealing runs a few degrees below Tm so primers stay bound long enough to extend, and magnesium, additives and template complexity all pull the effective temperature around. Treat the printed Tm as the center of a search, and let a gradient do the last few degrees.

Does sequence order matter, or only the counts?

To these rules, only the counts — ACGT and AGCT price identically. Real duplexes differ: stacking energy depends on neighbors, which is precisely what nearest-neighbor thermodynamics adds. The page’s honesty about that limit is the reason the 70 nt door exists.

Where do these formulas come from?

The A-T 2 / G-C 4 counting rule traces to Marmur and Doty’s 1962 measurements and the Wallace group’s 1979 immunology primers; the 64.9 formula is the bench descendant used across molecular-cloning manuals. Both assume neutral pH and no cosolvents, and both are quoted as approximations everywhere they appear — including here.

Related Chemistry & Biology Engines